Pedido rápido

Rat CD3g/CD3 gamma clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Rata CD3G Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001077646.1
    Tamaño de cDNA:549bp
    Descripción de cDNA:Full length Clone DNA of Rattus norvegicus CD3 molecule, gamma with N terminal His tag.
    Sinónimo de gen:Cd3g
    Especie:Rat
    Vector:pCMV3-SP-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD3G qPCR primers for gene expression analysis, RP300287 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Fondo

    CD3G gene encodes CD3-gamma polypeptide, which together with CD3-epsilon, -delta, and -zeta, and the TCR alpha/beta and gamma/delta heterodimers, forms the TCR-CD3 complex. This complex plays an important role in coupling antigen recognition to several intracellular signal-transduction pathways. The CD3 gamma chain has long been considered to mediate targeting to lysosomes for degradation. Defects in this gene are associated with T cell immunodeficiency. Further, it has been proposed as one of the important candidate genes for cancer development due to its pivotal roles in TCR signaling pathway.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Referencias
  • Jiang L, Xu J, Ni J, et al. A Functional Insertion/Deletion Polymorphism in the Proximal Promoter of CD3G Is Associated with Susceptibility for Hepatocellular Carcinoma in Chinese Population. DNA and Cell Biology.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"