After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat CD40 Ligand/CD40L/CD154 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat CD40LG Información de producto de clon de cDNA
Gene_bank_ref_id:NM_053353.1
Tamaño de cDNA:783bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus CD40 ligand with N terminal Flag tag.
Sinónimo de gen:Tnfsf5, Cd40lg
Especie:Rat
Vector:pCMV3-SP-N-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fondo

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD154, also known as CD40 ligand or CD40L, is a member of the TNF superfamily. While CD154 was originally found on T cell surface, its expression has since been found on a wide variety of cells, including platelets, mast cells, macrophages and NK cells. CD154's ability is achieved through binding to the CD40 on antigen- presenting cells (APC). In the macrophage cells, the primary signal for activation is IFN-γ from Th1 type CD4 T cells. The secondary signal is CD40L on the T cell, which interacting with the CD40 molecules, helping increase the level of activation.

Referencias
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Grewal IS, et al. (1998) CD40 and CD154 in cell-mediated immunity. Annual Review of Immunology. 16: 111-35.
  • Size / Price
    Catálogo: RG80177-NF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"