Pedido rápido

Rat CD47 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Rata CD47 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_019195.2
    Tamaño de cDNA:912bp
    Descripción de cDNA:Full length Clone DNA of Rattus norvegicus Cd47 molecule with C terminal His tag.
    Sinónimo de gen:Itgp, MGC93490, Cd47
    Especie:Rat
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CD47 qPCR primers for gene expression analysis, RP300281 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Fondo

    CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal cell binding domain of thrombospondin. It may play a role in membrane transport and signal transduction. CD47 is also a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. It is very broadly distributed on normal adult tissues, as well as ovarian tumors, being especially abundant in some epithelia and the brain. CD47 may play a role in membrane transport and/or integrin dependent signal transduction. It may prevent premature elimination of red blood cells. It also may be involved in membrane permeability changes induced following virus infection. By acting as an adhesion receptor for THBS1 on platelets, CD47 plays a role in both cell adhesion and in the modulation of integrins. It also plays an important role in memory formation and synaptic plasticity in the hippocampus.

    Immune Checkpoint
    Immune Checkpoint Detection: Antibodies   Immune Checkpoint Detection: ELISA Antibodies   Immune Checkpoint Detection: WB Antibodies
    Immune Checkpoint Targets   Co-inhibitory Immune Checkpoint Targets

    Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Referencias
  • Brown EJ, et al. (2001) Integrin-associated protein (CD47) and its ligands. Trends Cell Biol. 11(3): 130-5.
  • Oldenborg PA. (2004) Role of CD47 in erythroid cells and in autoimmunity. Leuk Lymphoma. 45(7): 1319-27.
  • Kaczorowski DJ, et al. (2007) Targeting CD47: NO limit on therapeutic potential. Circ Res. 100(5): 602-3.
  • Size / Price
    Catálogo: RG80305-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"