After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat CD53 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat CD53 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_012523.1
Tamaño de cDNA:660bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus Cd53 molecule with N terminal His tag.
Sinónimo de gen:OX44, Ox-44, RATOX44, Cd53
Especie:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fondo

CD53 is a member of the transmembrane 4 superfamily, also called the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. These proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. CD53 is a cell surface glycoprotein that is known to complex with integrins. Familial deficiency of CD53 gene has been linked to an immunodeficiency associated with recurrent infectious diseases caused by bacteria, fungi and viruses. CD53 contributes to the transduction of CD2-generated signals in T cells and natural killer cells and has been suggested to play a role in growth regulation.

Referencias
  • Rochelle JM, et al. (1993) Gene structure, chromosomal localization, and protein sequence of mouse CD53 (Cd53): evidence that the transmembrane 4 superfamily arose by gene duplication. Int Immunol. 5(2):209-16.
  • Virtaneva KI, et al. (1993) The genes for CD37, CD53, and R2, all members of a novel gene family, are located on different chromosomes. Immunogenetics. 37(6):461-5.
  • Horejsí V, et al. (1991) Novel structurally distinct family of leucocyte surface glycoproteins including CD9, CD37, CD53 and CD63. FEBS Lett. 288(1-2):1-4.
  • Size / Price
    Catálogo: RG80303-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"