After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat CD6 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_175577.3
Tamaño de cDNA:1998bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus Cd6 molecule with C terminal HA tag.
Sinónimo de gen:OX52, MGC108551, Cd6
Especie:Rat
Vector:pCMV3-C-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80311-ACG$245
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80311-ACR$245
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80311-CF$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80311-CH$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80311-CM$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80311-CY$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(Vector de expresión)RG80311-G$75
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80311-NF$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80311-NH$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80311-NM$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80311-NY$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación)RG80311-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

T-cell differentiation antigen CD6, also known as TP120 and CD6, is a single-pass type I membrane protein which contains three SRCR domains. CD6 / TP120 is a cell surface glycoprotein expressed primarily on T cells, it may function as a costimulatory molecule and may play a role in autoreactive immune responses. CD6 / TP120 is expressed by thymocytes, mature T-cells, a subset of B-cells known as B-1 cells, and by some cells in the brain. CD6 ligand termed CD166 (previously known as activated leukocyte cell adhesion molecule, ALCAM ) has been identified and shown to be expressed on activated T cells, B cells, thymic epithelium, keratinocytes, and in rheumatoid arthritis synovial tissue. CD6 / TP120 binds to activated leukocyte cell adhesion molecule ( CD166 ), and is considered as a costimulatory molecule involved in lymphocyte activation and thymocyte development. CD6 / TP120 partially associates with the TCR / CD3 complex and colocalizes with it at the center of the mature immunological synapse (IS) on T lymphocytes. During thymic development CD6-dependent signals may contribute both to thymocyte survival, and to the overall functional avidity of selection in both man and mouse.

Referencias
  • Joo YS. et al., 2000, Arthritis Rheum. 43 (2): 329-35.
  • Singer NG. et al., 2002, Int Immunol. 14 (6): 585-97.
  • Gimferrer I. et al., 2005, J Immunol. 175 (3): 1406-14.
  • Alonso R. et al., 2010, J Autoimmun. 35 (4): 336-41.
  • Size / Price
    Catálogo: RG80311-CY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"