Pedido rápido

Text Size:AAA

Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat CD6 Información de producto de clon de cDNA
Tamaño de cDNA:1998bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus Cd6 molecule with C terminal His tag.
Sinónimo de gen:OX52, MGC108551, Cd6
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80311-ACG$245
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80311-ACR$245
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80311-CF$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80311-CH$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80311-CM$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80311-CY$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(Vector de expresión)RG80311-G$75
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80311-NF$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80311-NH$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80311-NM$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80311-NY$215
Rat CD6 / Cluster of Differentiation 6 clonación del ADN o clonación génica(vector de clonación)RG80311-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

T-cell differentiation antigen CD6, also known as TP120 and CD6, is a single-pass type I membrane protein which contains three SRCR domains. CD6 / TP120 is a cell surface glycoprotein expressed primarily on T cells, it may function as a costimulatory molecule and may play a role in autoreactive immune responses. CD6 / TP120 is expressed by thymocytes, mature T-cells, a subset of B-cells known as B-1 cells, and by some cells in the brain. CD6 ligand termed CD166 (previously known as activated leukocyte cell adhesion molecule, ALCAM ) has been identified and shown to be expressed on activated T cells, B cells, thymic epithelium, keratinocytes, and in rheumatoid arthritis synovial tissue. CD6 / TP120 binds to activated leukocyte cell adhesion molecule ( CD166 ), and is considered as a costimulatory molecule involved in lymphocyte activation and thymocyte development. CD6 / TP120 partially associates with the TCR / CD3 complex and colocalizes with it at the center of the mature immunological synapse (IS) on T lymphocytes. During thymic development CD6-dependent signals may contribute both to thymocyte survival, and to the overall functional avidity of selection in both man and mouse.

  • Joo YS. et al., 2000, Arthritis Rheum. 43 (2): 329-35.
  • Singer NG. et al., 2002, Int Immunol. 14 (6): 585-97.
  • Gimferrer I. et al., 2005, J Immunol. 175 (3): 1406-14.
  • Alonso R. et al., 2010, J Autoimmun. 35 (4): 336-41.
  • Size / Price
    Catálogo: RG80311-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.