Pedido rápido

Text Size:AAA

Rat CD83 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat CD83 Información de producto de clon de cDNA
Tamaño de cDNA:592bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus Cd83 molecule with N terminal His tag.
Sinónimo de gen:Cd83
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD83 is considered as a marker of mature dendritic cells as well as an adhesion receptor that binds to resting monocytes and a subset of activated CD8+ T cells. In certain conditions, CD83 tended to dimerize or even multimerize through its aberrant intermolecular disulfide bonds. The injection of CD83-Ig can significantly enhaunce the rate of tumor growth and inhibit the T cell growth.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Scholler N, et al.(2002) Cutting Edge: CD83 Regulates the Development of Cellular Immunity. The Journal of Immunology. 168 (6): 2599-602.
  • Lechmann M, et al.(2002) CD83 on dendritic cells: more than just a marker for maturation. Trends in immunology. 23(6): 273-5.
  • Size / Price
    Catálogo: RG80333-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.