Pedido rápido

Text Size:AAA

Rat E-Cadherin/CDH1/E-cad/CD324 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat CDH1 Información de producto de clon de cDNA
Tamaño de cDNA:2706 bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus cadherin 1 with C terminal His tag.
Sinónimo de gen:Cdh1
Sitio de restricción:KpnI + XbaI(6kb+2.71kb)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rat E-Cadherin/CDH1/E-cad/CD324 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Rat E-Cadherin/CDH1/E-cad/CD324 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80274-ACG$325
Rat E-Cadherin/CDH1/E-cad/CD324 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80274-ACR$325
Rat E-Cadherin/CDH1/E-cad/CD324 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80274-CF$295
Rat E-Cadherin/CDH1/E-cad/CD324 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80274-CH$295
Rat E-Cadherin/CDH1/E-cad/CD324 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80274-CM$295
Rat E-Cadherin/CDH1/E-cad/CD324 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80274-CY$295
Rat E-Cadherin/CDH1/E-cad/CD324 clonación del ADN o clonación génica(Vector de expresión)RG80274-G$75
Rat E-Cadherin/CDH1/E-cad/CD324 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80274-NF$295
Rat E-Cadherin/CDH1/E-cad/CD324 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80274-NH$295
Rat E-Cadherin/CDH1/E-cad/CD324 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80274-NM$295
Rat E-Cadherin/CDH1/E-cad/CD324 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80274-NY$295
Rat E-Cadherin/CDH1/E-cad/CD324 clonación del ADN o clonación génica(vector de clonación)RG80274-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name

Cadherins are calcium-dependent cell adhesion proteins which preferentially interact with themselves in a homophilic manner in connecting cells, and thus may contribute to the sorting of heterogeneous cell type. E-cadherin (E-Cad), also known as CDH1 and CD324, is a calcium-dependent cell adhesion molecule the intact function of which is crucial for the establishment and maintenance of epithelial tissue polarity and structural integrity. Mutations in CDH1 occur in diffuse type gastric cancer, lobular breast cancer, and endometrial cancer. In human cancers, partial or complete loss of E-cadherin expression correlates with malignancy. During apoptosis or with calcium influx, E-Cad is cleaved by the metalloproteinase to produce fragments of about 38 kDa (E-CAD/CTF1), 33 kDa (E-CAD/CTF2) and 29 kDa (E-CAD/CTF3), respectively. E-Cad has been identified as a potent invasive suppressor, as downregulation of E-cadherin expression is involved in dysfunction of the cell-cell adhesion system, and often correlates with strong invasive potential and poor prognosis of human carcinomas.

  • Wang HD, et al. (2004) CDH1 germline mutation in hereditary gastric carcinoma. World J Gastroenterol. 10(21): 3088-93.
  • Masterson J, et al. (2007) Posttranslational truncation of E-cadherin and significance for tumour progression. Cells Tissues Organs. 185(1-3): 175-9.
  • Mrgineanu E, et al. (2008) Correlation between E-cadherin abnormal expressions in different types of cancer and the process of metastasis. Rev Med Chir Soc Med Nat Iasi. 112(2): 432-6.
  • Size / Price
    Catálogo: RG80274-CH
    Precio de lista: 
    Precio:      (You Save: )
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.