After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat CDH13 Información de producto de clon de cDNA
Tamaño de cDNA:2145bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus cadherin 13 with N terminal His tag.
Sinónimo de gen:Cdht, Tcad, MGC93172, T-cadherin, Cdh13
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Rat CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
Rat CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80280-ACG$245
Rat CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80280-ACR$245
Rat CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80280-CF$215
Rat CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80280-CH$215
Rat CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80280-CM$215
Rat CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80280-CY$215
Rat CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(Vector de expresión)RG80280-G$75
Rat CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80280-NF$215
Rat CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80280-NH$215
Rat CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80280-NM$215
Rat CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80280-NY$215
Rat CDH13 / Cadherin-13 / H Cadherin clonación del ADN o clonación génica(vector de clonación)RG80280-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name

CDH13, also known as cadherin-13 and H Cadherin, is a member of the cadherin superfamily. CDH13 acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. CDH13 is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. CDH13 gene is hypermethylated in many types of cancer.

  • Hart AB. et al., 2012, PLoS One. 7 (8): e42646.
  • Xu J. et al., 2012, BMC Cancer. 12: 243.
  • Jo J. et al., 2012, Obesity (Silver Spring). 20 (8): 1683-7.
  • Size / Price
    Catálogo: RG80280-NH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.