Pedido rápido

Rat KSP-Cadherin/Cadherin-16 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat CDH16 Información de producto de clon de cDNA
Tamaño de cDNA:2493bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus cadherin 16 with C terminal His tag.
Sinónimo de gen:Cdh16
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rat KSP-Cadherin/Cadherin-16 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Product nameProduct name

KSP-Cadherin/Cadherin-16 is a member of the cadherin superfamily, calcium-dependent, membrane-associated glycoproteins. The protein consists of an extracellular domain containing 6 cadherin domains, a transmembrane region and a truncated cytoplasmic domain but lacks the prosequence and tripeptide HAV adhesion recognition sequence typical of most classical cadherins. Expression is exclusively in kidney, where the protein functions as the principal mediator of homotypic cellular recognition, playing a role in the morphogenic direction of tissue development. KSP-Cadherin/Cadherin-16 can be detected at later stages of tubulogenesis during human renal development and in the distal tubules of adult kidneys, no expression was found by immunohistochemistry or Western blot analysis in RCC tumour tissues and several RCC cell lines. However, despite the lack of protein expression, mRNA synthesis of KSP-Cadherin/Cadherin-16 could be detected by reverse transcriptase-polymerase chain reaction analysis in all RCC tissues and most of the RCC cell lines studied, although at a reduced level. The loss of KSP-Cadherin/Cadherin-16 protein was only observed in the malignant part of the tumour kidneys, whereas in the normal part of the affected kidneys KSP-Cadherin/Cadherin-16 expression was clearly detected. These results indicate a downregulation of Ksp-cadherin in RCC and suggest a role for this cell adhesion molecule in tumour suppression.

  • Thomson RB, et al. (1999) Immunolocalization of Ksp-cadherin in the adult and developing rabbit kidney. Am J Physiol. 277 (1): 146-56.
  • Thedieck C, et al. (2005) Expression of Ksp-cadherin during kidney development and in renal cell carcinoma. Br J Cancer. 92(11): 2010-7.
  • Bai Y, et al. (2002) Regulation of kidney-specific Ksp-cadherin gene promoter by hepatocyte nuclear factor-1beta. Am J Physiol Renal Physiol. 283(4): 839-51.
  • Size / Price
    Catálogo: RG80282-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.