After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Rat CHMP1B Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001109533.1
Tamaño de cDNA:591bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus charged multivesicular body protein 1B.
Sinónimo de gen:Chmp1b
Especie:Rat
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación) on other vectors
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG81019-ACG$225
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG81019-ACR$225
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG81019-ANG$225
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG81019-ANR$225
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG81019-CF$195
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG81019-CH$195
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG81019-CM$195
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG81019-CY$195
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG81019-NF$195
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG81019-NH$195
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG81019-NM$195
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG81019-NY$195
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(Vector de expresión)RG81019-U$75
Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación)RG81019-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: RG81019-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"