Pedido rápido

Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Rata CHMP1B Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001109533.1
    Tamaño de cDNA:591bp
    Descripción de cDNA:Full length Clone DNA of Rattus norvegicus charged multivesicular body protein 1B.
    Sinónimo de gen:Chmp1b
    Especie:Rat
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CHMP1B qPCR primers for gene expression analysis, RP300983 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación) on other vectors
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG81019-ACG$225
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG81019-ACR$225
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG81019-ANG$225
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG81019-ANR$225
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG81019-CF$195
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG81019-CH$195
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG81019-CM$195
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG81019-CY$195
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG81019-NF$195
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG81019-NH$195
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG81019-NM$195
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG81019-NY$195
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(Vector de expresión)RG81019-U$75
    Rat C10orf2/CHMP1B clonación del ADN o clonación génica(vector de clonación)RG81019-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: RG81019-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"