After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat CLEC4B2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001005896.1
Tamaño de cDNA:627bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 4, member B2 with C terminal His tag.
Sinónimo de gen:Aplra1, Clec4b2
Especie:Rat
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80265-ACG$225
Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80265-ACR$225
Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG80265-ANG$225
Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG80265-ANR$225
Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80265-CF$195
Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80265-CH$195
Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80265-CM$195
Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80265-CY$195
Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(Vector de expresión)RG80265-G$75
Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80265-NF$195
Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80265-NH$195
Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80265-NM$195
Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80265-NY$195
Rat CLEC4B2 / mDCAR1 clonación del ADN o clonación génica(vector de clonación)RG80265-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Clec4b2, also known as mDCAR1, is a member of the DCIR/DCAR family. Expression of Clec4b2 was strongly tissue dependent. Clec4b2 expression on DCs was restricted to the CD8(+) DC subset in spleen and thymus and on subpopulations of CD11b(+) myeloid cells in bone marrow and spleen, whereas the molecule was not detectable on both cell types in lymph nodes and peripheral blood. Clec4b2 is a functional receptor on cells of the immune system and provides further insights into the regulation of immune responses by CLRs.

Referencias
  • Katayama S. et al., 2005, Science. 309 (5740): 1564-6.
  • Kaden SA. et al., 2009, J Immunol. 183 (8): 5069-78.
  • Skarnes WC. et al., 2011, Nature. 474 (7351): 337-42.
  • Size / Price
    Catálogo: RG80265-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"