CLPS cDNA ORF Clone, Rat, untagged

Price:
Size:
Number:

CLPS cDNA ORF Clone, Rat, untagged: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
339 bp
Description
Full length Clone DNA of Rat colipase, pancreatic.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

CLPS Background Information

Colipase belongs to the colipase family. Structural studies of the complex and of colipase alone have revealed the functionality of its architecture. It is a small protein with five conserved disulphide bonds. Structural analogies have been recognised between a developmental protein, the pancreatic lipase C-terminal domain, the N-terminal domains of lipoxygenases and the C-terminal domain of alpha-toxin. Colipase can only be detected in pancreatic acinar cells, suggesting regulation of expression by tissue-specific elements. Colipase allows lipase to anchor noncovalently to the surface of lipid micelles, counteracting the destabilizing influence of intestinal bile salts. Without colipase the enzyme is washed off by bile salts, which have an inhibitory effect on the lipase. Colipase is a cofactor needed by pancreatic lipase for efficient dietary lipid hydrolysis. It binds to the C-terminal, non-catalytic domain of lipase, thereby stabilising as active conformation and considerably increasing the overall hydrophobic binding site.
Full Name
colipase, pancreatic
References
  • Davis RC, et al. (1991) Assignment of the human pancreatic colipase gene to chromosome 6p21.1 to pter. Genomics. 10(1):262-5.
  • Lowe ME. (1997) Structure and function of pancreatic lipase and colipase. Annu Rev Nutr. 17: 141-58.
  • Verger R, et al. (1999) Colipase: structure and interaction with pancreatic lipase. Biochim Biophys Acta. 1441(2-3):173-84.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait