Pedido rápido

Rat Contactin 1/CNTN1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Rata CNTN1 Información de producto de clon de cDNA
    Tamaño de cDNA:3066bp
    Descripción de cDNA:Full length Clone DNA of Rattus norvegicus contactin 1 with N terminal His tag.
    Sinónimo de gen:F3, Cntn1
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    ( We provide with CNTN1 qPCR primers for gene expression analysis, RP300288 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Rat Contactin 1/CNTN1 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta on other vectors
    Product nameProduct name

    Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2 (TAG-1), Contactin-3 (BIG-1), BIG-2, Contactin-5 (NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-1 is a cell surface adhesion molecule that is normally expressed by neurons and oligodendrocytes. Particularly high levels of Contactin-1 are present during brain development. Contactin-1 and Contactin-2 are differentially expressed in a number of neuronal tissues during development, and they interact with several ligands including Nr-CAM, L1, NCAM, neurocan, phosphacan, and tenascin. As a cell adhesion molecule, Contactin-1 plays a role in the formation of axon connections in the developing nervous system. It was demonstrated that Contactin-1 participates in signal pathways via its association with Contactin-associated protein (CNTNAP1), receptor protein tyrosine phosphatase beta (RPTPb) and NOTCH1. Contactin-1 is also involved in paranodal axo-glial junction formation and oligodendrocytes generation. Furthermore, studies indicated that Contactin-1 functions importantly in the invasion and metastasis of lung adenocarcinoma cells. Contactin-1 may also significantly influence the functional expression and distribution of Na+ channels in neurons.

  • Kazarinova NK, et al. (2001) Contactin associates with Na+ channels and increases their functional expression. J Neurosci. 21 (19):7517-25.
  • Eckerich C, et al. (2006) Contactin is expressed in human astrocytic gliomas and mediates repulsive effects. Glia. 53(1):1-12.
  • Su JL, et al. (2006) Knockdown of contactin-1 expression suppresses invasion and metastasis of lung adenocarcinoma. Cancer research 66 (5):2553-61.
  • Compton AG, et al. (2008) Mutations in contactin-1, a neural adhesion and neuromuscular junction protein, cause a familial form of lethal congenital myopathy. Am J Hum Genet. 83 (6):714-24.
  • Mikami T, et al. (2009) Contactin-1 is a functional receptor for neuroregulatory chondroitin sulfate-E. J Biol Chem. 284(7):4494-9.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.