Alpha B Crystallin cDNA ORF Clone, Rat, N-Myc tag

Price:
Size:
Number:

Alpha B Crystallin cDNA ORF Clone, Rat, N-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
528 bp
Description
Full length Clone DNA of Rat crystallin, alpha B with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Alpha B Crystallin Background Information

Alpha B-Crystallin (CRYAB) is purported to be a metastasis suppressor protein, and lack or lower CRYAB expression is a prognostic biomarker for several types of cancer, such as that of the prostate and head and neck. Mutations in alpha-B crystallin gene (CRYAB) have been described to cause congenital cataracts, dilated cardiomyopathy and myofibrillar myopathy. Mutations in the alphaB-crystallin (CRYAB) gene, encoding a small heat shock protein with chaperone function, are a rare cause of myofibrillar myopathy with autosomal-dominant inheritance, late-onset and moderate severity. Mutations in the CRYAB gene, encoding alpha-B crystallin, cause distinct clinical phenotypes including isolated posterior polar cataract, myofibrillar myopathy, cardiomyopathy, or a multisystemic disorder combining all these features. CRYAB may be identified as a novel prognostic marker and targeting CRYAB may provide a promising strategy for NSCLC treatment.
Full Name
crystallin, alpha B
Add to Cart Successfully Add to Cart Failed