DPP6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag

Price:
Size:
Number:

DPP6 cDNA ORF Clone, Rat, N-DDK (Flag®) tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2412 bp
Description
Full length Clone DNA of Rat dipeptidylpeptidase 6 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

DPP6 Background Information

Dipeptidyl peptidase-like protein 6 (DPP6), a member of the dipeptidyl aminopeptidase family, plays distinct roles in brain development. Dipeptidyl peptidase-like protein 6 (DPP6) is an auxiliary subunit of the Kv4 family of voltage-gated K(+) channels known to enhance channel surface expression and potently accelerate their kinetics. DPP6 is a single transmembrane protein, which is structurally remarkable for its large extracellular domain. DPP6 is well known as an auxiliary subunit of Kv4-containing, A-type K(+) channels which regulate dendritic excitability in hippocampal CA1 pyramidal neurons. We have recently reported, however, a novel role for DPP6 in regulating dendritic filopodia formation and stability, affecting synaptic development and function.
Full Name
dipeptidyl-peptidase 6
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait