Pedido rápido

Rat Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Rat F11R Información de producto de clon de cDNA
Gene_bank_ref_id:NM_053796.1
Tamaño de cDNA:903bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus F11 receptor.
Sinónimo de gen:Jam1, F11r
Especie:Rat
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Rat Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación) on other vectors
Rat Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80240-ACG$225
Rat Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80240-ACR$225
Rat Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80240-CF$195
Rat Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80240-CH$195
Rat Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80240-CM$195
Rat Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80240-CY$195
Rat Junctional Adhesion Molecule A clonación del ADN o clonación génica(Vector de expresión)RG80240-G$75
Rat Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80240-NF$195
Rat Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80240-NH$195
Rat Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80240-NM$195
Rat Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80240-NY$195
Rat Junctional Adhesion Molecule A clonación del ADN o clonación génica(vector de clonación)RG80240-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Junctional adhesion molecule-A (JAM-A), also known as F11 receptor (F11R) or Cluster of Differentiation 321 (CD321), is a transmembrane protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. JAM-A protein serves as a serotype-independent receptor for mammalian orthoreoviruses (reoviruses). It is also a ligand for the integrin LFA1, involves in leukocyte transmigration. As a cell adhesion molecule of the immunoglobulin superfamily, JAM-A protein involves in platelet adhesion, secretion and aggregation, and plays a crucial role in inflammatory thrombosis and atherosclerosis. In addition, it may be a potential therapeutic target for breast cancer.

Referencias
  • Guglielmi KM, et al. (2007) Reovirus binding determinants in junctional adhesion molecule-A. J Biol Chem. 282(24): 17930-40.
  • Yeung D, et al. (2008) Decreased junctional adhesion molecule-A expression during blood-brain barrier breakdown. Acta Neuropathol. 115(6): 635-42.
  • Ong KL, et al. (2009) Elevated plasma level of soluble F11 receptor/junctional adhesion molecule-A (F11R/JAM-A) in hypertension. Am J Hypertens. 22(5): 500-5.
  • Size / Price
    Catálogo: RG80240-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"