Pedido rápido

Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Rata FKBP1A Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_013102.3
    Tamaño de cDNA:327bp
    Descripción de cDNA:Full length Clone DNA of Rattus norvegicus FK506 binding protein 1a with C terminal Flag tag.
    Sinónimo de gen:Fkbp2, FKBP12
    Especie:Rat
    Vector:pCMV3-C-FLAG
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FKBP1A qPCR primers for gene expression analysis, RP301095 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG81138-ACG$225
    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG81138-ACR$225
    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG81138-ANG$225
    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG81138-ANR$225
    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG81138-CF$195
    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG81138-CH$195
    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG81138-CM$195
    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG81138-CY$195
    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG81138-NF$195
    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG81138-NH$195
    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG81138-NM$195
    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG81138-NY$195
    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(Vector de expresión)RG81138-U$75
    Rat FKBP12/FKBP1A clonación del ADN o clonación génica(vector de clonación)RG81138-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    FK506 binding protein 12 (FKBP12), also known as FKBP1, along with cyclophilin, are two major members of the immunophilin protein family who serve as receptors for the immunosuppressant drugs cyclosporin A and FK506. As a conserved molecules in many eukaryotes, FKBP12 has been characterized as a peptidyl-prolyl isomerase that catalyzes the transition between cis- and trans-proline residues, and is involved in several biochemical processes including protein folding, receptor signaling, protein trafficking and transcription. FKBP12 has attracted immense attention and its role in mediating the immunosuppressive functions. FKBP12 serves a dual role as a peptidyl-prolyl cis-trans isomerase and as a modulator of several cell signaling pathways. In one such a role, FKBP12 interacts with and regulates the functional state of the ryanodine Ca2+ channel receptor by altering protein conformation and coordinating multi-protein complex formation. Another physiological role of FKBP12 is an interactor and a regulator of the type I serine/threonine kinase receptors of TGF-beta superfamily. Current data, derived from detailed biochemical studies as well as from functional studies in various systems, suggest that FKBP12 functions as a "guardian" for the type I receptors to prevent them from leaky signaling under sub-optimal ligand concentrations, thereby providing a molecular "gradient reader" for TGF-beta family morphogens. This aspect of FKBP12 function may be critical for cellular responsiveness to morphogenetic gradients of the TGF-beta family members during early development, serving to assure the translation of different ligand concentrations into different signaling readouts. In addition, FKBP12 may be involved in neuronal or astrocytic cytoskeletal organization and in the abnormal metabolism of tau protein in Alzheimer's disease (AD) damaged neurons.

    Referencias
  • Wang T, et al. (2004) The immunophilin FKBP12: a molecular guardian of the TGF-beta family type I receptors. Front Biosci. 9: 619-31.
  • Sugata H, et al. (2009) A peptidyl-prolyl isomerase, FKBP12, accumulates in Alzheimer neurofibrillary tangles. Neurosci Lett. 459(2): 96-9.
  • Brath U, et al. (2009) Differential responses of the backbone and side-chain conformational dynamics in FKBP12 upon binding the transition-state analog FK506: implications for transition-state stabilization and target protein recognition. J Mol Biol. 387(1): 233-44.
  • Scaramello CB, et al.. (2009) FKBP12 depletion leads to loss of sarcoplasmic reticulum Ca(2+) stores in rat vas deferens. J Pharmacol Sci. 109(2): 185-92.
  • Size / Price
    Catálogo: RG81138-CF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"