Pedido rápido

Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat FTL Información de producto de clon de cDNA
Gene_bank_ref_id:BC061525.1
Tamaño de cDNA:552bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus ferritin, light polypeptide with N terminal HA tag.
Sinónimo de gen:Ftl1
Especie:Rat
Vector:pCMV3-N-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta on other vectors
Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80491-ACG$225
Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80491-ACR$225
Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG80491-ANG$225
Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG80491-ANR$225
Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80491-CF$195
Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80491-CH$195
Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80491-CM$195
Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80491-CY$195
Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80491-NF$195
Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80491-NH$195
Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80491-NM$195
Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80491-NY$195
Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(Vector de expresión)RG80491-U$75
Rat FTL/ferritin, light polypeptide clonación del ADN o clonación génica(vector de clonación)RG80491-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Ferritin, light polypeptide (FTL) is the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Storage of iron in the tissues occurs in the form of ferritin and hemosiderin. The latter originates from ferritin that has undergone intracellular digestion of its protein shell, leaving the iron core. Ferritin and hemosiderin are components of a continuum. Ferritin has been identified in all types of living organisms: animals, plants, molds, and bacteria. Whithin the protein shell of ferritin, iron is first oxidized to the ferric state for storage as ferric oxyhdroxide. Thus, ferritin removes excess iron from the cell sap where it could otherwise participate in peroxidation mechanisms.

Referencias
  • Munro HN, et al. (1988) The ferritin genes: structure, expression, and regulation. Ann N Y Acad Sci. 526: 113-23.
  • Zhang Y, et al. (2008) Comparative proteomic analysis of human placenta derived from assisted reproductive technology. Proteomics. 8 (20): 4344-56.
  • Lebo RV, et al. (1986) Human ferritin light chain gene sequences mapped to several sorted chromosomes. Hum Genet. 71 (4): 325-8.
  • Size / Price
    Catálogo: RG80491-NY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"