Pedido rápido

Text Size:AAA

Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Rata HAAO Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_020076.2
    Tamaño de cDNA:861bp
    Descripción de cDNA:Full length Clone DNA of Rattus norvegicus 3-hydroxyanthranilate 3,4-dioxygenase with C terminal His tag.
    Sinónimo de gen:Haao
    Especie:Rat
    Vector:pCMV3-C-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HAAO qPCR primers for gene expression analysis, RP300591 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
    Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80627-ACG$225
    Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80627-ACR$225
    Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG80627-ANG$225
    Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG80627-ANR$225
    Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80627-CF$195
    Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80627-CH$195
    Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80627-CM$195
    Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80627-CY$195
    Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80627-NF$195
    Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80627-NH$195
    Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80627-NM$195
    Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80627-NY$195
    Rat HAAO / 3-HAO clonación del ADN o clonación génica(Vector de expresión)RG80627-U$75
    Rat HAAO / 3-HAO clonación del ADN o clonación génica(vector de clonación)RG80627-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Size / Price
    Catálogo: RG80627-CH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"