After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Rat HSP90AB1 Información de producto de clon de cDNA
Gene_bank_ref_id:AY695393.1
Tamaño de cDNA:2175bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus heat shock protein 90 alpha (cytosolic), class B member 1.
Sinónimo de gen:HSPC2, Hspcb, HSP90B, HSP90-BETA
Especie:Rat
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación) on other vectors
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG81038-ACG$245
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG81038-ACR$245
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG81038-ANG$245
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG81038-ANR$245
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG81038-CF$215
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG81038-CH$215
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG81038-CM$215
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG81038-CY$215
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG81038-NF$215
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG81038-NH$215
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG81038-NM$215
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG81038-NY$215
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(Vector de expresión)RG81038-U$75
Rat HSP90/HSP90AB1 clonación del ADN o clonación génica(vector de clonación)RG81038-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: RG81038-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"