Pedido rápido

Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Rata HSPD1 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_022229.2
    Tamaño de cDNA:1722bp
    Descripción de cDNA:Full length Clone DNA of Rattus norvegicus heat shock protein 1 (chaperonin).
    Sinónimo de gen:Hsp60,Hspd1-30p
    Especie:Rat
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HSPD1 qPCR primers for gene expression analysis, RP300978 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG81014-ACG$245
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG81014-ACR$245
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG81014-ANG$245
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG81014-ANR$245
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG81014-CF$215
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG81014-CH$215
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG81014-CM$215
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG81014-CY$215
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG81014-NF$215
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG81014-NH$215
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG81014-NM$215
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG81014-NY$215
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(Vector de expresión)RG81014-U$75
    Rat HSPD1/HSP60 clonación del ADN o clonación génica(vector de clonación)RG81014-UT$215
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    HSPD1, also known as HSP60, is a member of the chaperonin family. HSPD1 may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. It may also prevent misfolding and promote the refolding and proper assembly of unfolded polypeptides generated under stress conditions in the mitochondrial matrix. HSPD1 gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13.Defects in HSPD1 are a cause of spastic paraplegia autosomal dominant type 13 (SPG13). Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Defects in HSPD1 are the cause of leukodystrophy hypomyelinating type 4 (HLD4); also called mitochondrial HSP60 chaperonopathy or MitCHAP-60 disease. HLD4 is a severe autosomal recessive hypomyelinating leukodystrophy. HSPD1 is cinically characterized by infantile-onset rotary nystagmus, progressive spastic paraplegia, neurologic regression, motor impairment, profound mental retardation. Death usually occurrs within the first two decades of life.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Referencias
  • Hansen J J, et al. (2002) Hereditary spastic paraplegia SPG13 is associated with a mutation in the gene encoding the mitochondrial chaperonin Hsp60. Am J Hum Genet. 70: 1328-32.
  • Magen D, et al. (2008) Mitochondrial Hsp60 chaperonopathy causes an autosomal-recessive neurodegenerative disorder linked to brain hypomyelination and leukodystrophy. Am J Hum Genet. 83: 30-42.
  • Venner TJ, et al. (1990) Nucleotide sequences and novel structural features of human and Chinese hamster hsp60 (chaperonin) gene families. DNA Cell Biol. 9 (8): 545-52.
  • Size / Price
    Catálogo: RG81014-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"