After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rat ICAM-2/CD102 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Rat ICAM2 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001007725.1
Tamaño de cDNA:834bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus intercellular adhesion molecule 2.
Sinónimo de gen:MGC95023, Icam2
Especie:Rat
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fondo

Intercellular adhesion molecule 2 (ICAM-2, CD102), belongs to the ICAM family consisting of three members identified as ligands for integrin receptors. It is a type I transmembrane glycoprotein with two Ig-like C2-type domains, and binds to the leukocyte integrins LFA-1 (CD11a/CD18) and Mac-1 (CD11b/CD18). As a second ligand of leukocyte function-associated antigen-1, ICAM-2 functions as a costimulatory molecule for effector cells. ICAM-2 is mainly expressed on vascular endothelial and hematopoietic cells. Interactions of ICAM-2 and the integrin receptors mediate cell adhesion in a wide range of lymphocyte, monocyte, natural killer cell, and granulocytewith other cells, and play important roles in many adhesion-dependent immune and inflammation responses, such as T cell aggregation, NK-cell cytotoxicity and migration, lymphocyte recirculation, etc. Serum levels of ICAM-2 correlated significantly with the inflammatory and course sequences of trichinosis in mice and had a similar relation with blood eosinophilia. So, estimation of ICAM-2 serum levels may prove useful in diagnosis of trichinosis recent infections, and in monitoring the prognosis and response to treatment.

Referencias
  • Weber KS, et al. (2004) Sialylation of ICAM-2 on platelets impairs adhesion of leukocytes via LFA-1 and DC-SIGN. Inflammation. 28(4): 177-88.
  • Tanaka H, et al. (2004) ICAM-2 gene therapy for peritoneal dissemination of scirrhous gastric carcinoma. Clin Cancer Res. 10(14): 4885-92.
  • Younis AI, et al. (2005) Intercellular adhesion molecule-2 (ICAM-2) in experimental trichinosis. J Egypt Soc Parasitol. 35(3): 1019-26.
  • Size / Price
    Catálogo: RG80239-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"