Pedido rápido

Rat IFN-alpha / IFNA1 / IFN clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat IFNA1 Información de producto de clon de cDNA
Tamaño de cDNA:579bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus interferon-alpha 1 with N terminal Flag tag.
Sinónimo de gen:IFN-alpha1, Ifna1
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rat IFN-alpha / IFNA1 / IFN clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Product nameProduct name

IFNA1, also known as IFN-alpha and IFNA, belongs to the alpha/beta interferon family. Interferons(IFNs) are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumor cells. They belong to the large class of glycoproteins known as cytokines. IFNs stimulate the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. IFNs can activate immune cells, such as natural killer cells and macrophages; they increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes; and they also increase the ability of uninfected host cells to resist new infection by virus.Leukocyte interferon is produced predominantly by B lymphocytes. Immune interferon is produced by mitogen- or antigen-stimulated T lymphocytes. IFNA1 is produced by macrophages and has antiviral activities.

  • Takayama I, et al. (2012) The nucleocapsid protein of measles virus blocks host interferon response. Virology. 424(1):45-55.
  • Vairo D, et al. (2011) Severe impairment of IFN-? and IFN-? responses in cells of a patient with a novel STAT1 splicing mutation. Blood. 118(7):1806-17.
  • Bhattacharya S, et al. (2011) Bcr-abl signals to desensitize chronic myeloid leukemia cells to IFN? via accelerating the degradation of its receptor. Blood. 118(15):4179-87.
  • Size / Price
    Catálogo: RG80174-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.