After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rat Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Rat IFNG Información de producto de clon de cDNA
Gene_bank_ref_id:NM_138880.2
Tamaño de cDNA:471bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus ?interferon gamma.
Sinónimo de gen:IFNG2, Ifng
Especie:Rat
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Rat Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación) on other vectors
Rat Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80234-ACG$225
Rat Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80234-ACR$225
Rat Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80234-CF$195
Rat Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80234-CH$195
Rat Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80234-CM$195
Rat Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80234-CY$195
Rat Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(Vector de expresión)RG80234-G$75
Rat Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80234-NF$195
Rat Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80234-NH$195
Rat Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80234-NM$195
Rat Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80234-NY$195
Rat Interferon Gamma/IFN gamma/IFNG clonación del ADN o clonación génica(vector de clonación)RG80234-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

Referencias
  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.
  • Size / Price
    Catálogo: RG80234-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"