After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rat CD219 / IL10RA clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat IL10RA Información de producto de clon de cDNA
Gene_bank_ref_id:NM_057193.2
Tamaño de cDNA:1710bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus interleukin 10 receptor, alpha with N terminal Flag tag.
Sinónimo de gen:Il10ra, IL-10ra
Especie:Rat
Vector:pCMV3-SP-N-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Fondo

CD219, also known as IL10RA, is a receptor for interleukin 10. CD219 has been shown to mediate the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. It is structurally related to IFN receptors. It has been reported that CD219 promotes survival of progenitor myeloid cells. Activation of CD219 leads to tyrosine phosphorylation of JAK1 and TYK2 kinases.

Referencias
  • Josephson K, et al. (2001) Purification, crystallization and preliminary X-ray diffraction of a complex between IL-10 and soluble IL-10R1. Acta Crystallogr D Biol Crystallogr. 57(Pt 12): 1908-11.
  • Tan, J C, et al. (1995) Characterization of recombinant extracellular domain of human interleukin-10 receptor. J Biol Chem. 270(21):12906-11.
  • Josephson, K, et al. (2001) Crystal structure of the IL-10/IL-10R1 complex reveals a shared receptor binding site. Immunity. 15(1):35-46.
  • Size / Price
    Catálogo: RG80183-NF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"