Pedido rápido

Rat IL13RA1/IL-13RA1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat IL13RA1 Información de producto de clon de cDNA
Tamaño de cDNA:1281bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus interleukin 13 receptor, alpha 1 with N terminal Flag tag.
Sinónimo de gen:MGC105309, LOC100360218, Il13ra1
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Interleukin 13 receptor, alpha 1, also known as IL13RA1/IL-13RA1 and CD213A1 (cluster of differentiation 213A1), is a subunit of the interleukin 13 receptor. This subunit forms a receptor complex with IL4 receptor alpha, a subunit shared by IL13 and IL4 receptors. IL13RA1/IL-13RA1 serves as a primary IL13-binding subunit of the IL13 receptor, and may also be a component of IL4 receptors. This protein has been shown to bind tyrosine kinase TYK2, and thus may mediate the signaling processes that lead to the activation of JAK1, STAT3 and STAT6 induced by IL13 and IL4. IL13RA1/IL-13RA1 binds with low affinity to interleukin-13 (IL13). This subunit together with IL4RA can form a functional receptor for IL13. IL13RA1/IL-13RA1 also serves as an alternate accessory protein to the common cytokine receptor gamma chain for interleukin-4 (IL4) signaling, but cannot replace the function of IL2RG in allowing enhanced interleukin-2 (IL2) binding activity.

  • Kawakami M, et al. (2002) Mutation and functional analysis of IL-13 receptors in human malignant glioma cells. Oncol Res. 12 (11-12): 459-67.
  • Umeshita-Suyama R, et al. (2000) Characterization of IL-4 and IL-13 signals dependent on the human IL-13 receptor alpha chain 1: redundancy of requirement of tyrosine residue for STAT3 activation. Int Immunol. 12 (11): 1499-509.
  • He JQ, et al. (2003) Polymorphisms in the IL13, IL13RA1, and IL4RA genes and rate of decline in lung function in smokers. Am J Respir. Cell Mol Biol. 28 (3): 379-85.
  • Size / Price
    Catálogo: RG80186-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.