Pedido rápido

Rat CD122 / IL-2RB clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Rata IL2RB Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_013195.1
    Tamaño de cDNA:1614bp
    Descripción de cDNA:Full length Clone DNA of Rattus norvegicus interleukin 2 receptor, beta with C terminal HA tag.
    Sinónimo de gen:IL2RBC, Il2rb
    Especie:Rat
    Vector:pCMV3-C-HA
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IL2RB qPCR primers for gene expression analysis, RP300310 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Fondo

    Interleukin-2 receptor (IL-2R) also known as High affinity IL-2 receptor subunit beta, IL-2 receptor subunit beta, and IL-2RB, is involved in T cell-mediated immune responses. CD122/IL-2RB is present in 3 forms with respect to ability to bind interleukin 2. The low affinity form is a monomer of the alpha subunit and is not involved in signal transduction. The intermediate affinity form consists of an alpha/beta subunit heterodimer, while the high affinity form consists of an alpha/beta/gamma subunit heterotrimer. Both the intermediate and high affinity forms of CD122/IL-2RB are involved in receptor-mediated endocytosis and transduction of mitogenic signals from interleukin 2. CD122/IL-2RB expression was restricted to the earliest B220+ cells (CD43+CD24-; prepro B cells; fraction A) that proliferate vigorously to IL-2 in the absence of any stromal cells, but not to IL-15. The high-affinity form of this receptor is expressed on activated T lymphocytes, activated B lymphocytes, and activated macrophages. CD122/IL-2RB plays a role in regulating normal lymphocyte development.

    Referencias
  • Foss F. (2006) Clinical experience with denileukin diftitox (ONTAK). Semin Oncol. 33(1 Suppl 3): 11-6.
  • Sprent J, et al. (2001) T cell death and memory. Science. 293(5528): 245-8.
  • Teshigawara K, et al. (1987) Interleukin 2 high-affinity receptor expression requires two distinct binding proteins. J Exp Med. 165 (1): 223-38.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"