After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rat IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat IL7 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_013110.2
Tamaño de cDNA:465bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus interleukin 7 with C terminal HA tag.
Sinónimo de gen:Il1a, IL-1alpha
Especie:Rat
Vector:pCMV3-C-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Rat IL7/IL-7/Interleukin-7 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Product nameProduct name
Fondo

IL7, also known as interleukin 7, is a hematopoietic growth factor which belongs to the IL-7/IL-9 family. It is secreted by stromal cells in the bone marrow and thymus. IL7 stimulates the proliferation of lymphoid progenitors. It is important for proliferation during certain stages of B-cell maturation. IL7 and the hepatocyte growth factor (HGF) form a heterodimer that functions as a pre-pro-B cell growth-stimulating factor. It is found to be a cofactor for V(D)J rearrangement of the T cell receptor beta (TCRß) during early T cell development. IL7 can be produced locally by intestinal epithelial and epithelial goblet cells, and may serve as a regulatory factor for intestinal mucosal lymphocytes.

Referencias
  • Watanabe M, et al. (1995) Interleukin 7 is produced by human intestinal epithelial cells and regulates the proliferation of intestinal mucosal lymphocytes.
  • J Clin Invest. 95(6):2945-53. Sawa Y, et al. (2009) Hepatic interleukin-7 expression regulates T cell responses. Immunity. 30 (3):447-57.
  • Flad HD, et al. (1996) Human follicular dendritic cells and vascular cells produce interleukin-7: a potential role for interleukin-7 in the germinal center reaction. Eur J Immunol. 26(10): 2541-4.
  • Size / Price
    Catálogo: RG80329-CY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"