Pedido rápido

Text Size:AAA

Rat IL-9 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat IL9 Información de producto de clon de cDNA
Tamaño de cDNA:435bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus interleukin 9 with N terminal HA tag.
Sinónimo de gen:IL9
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Interleukin 9, also known as IL-9, is a cytokine (cell signalling molecule) belonging to the group of interleukins. IL-9 is a cytokine that acts as a regulator of a variety of hematopoietic cells. This cytokine stimulates cell proliferation and prevents apoptosis. It functions through the interleukin 9 receptor (IL-9R), which activates different signal transducer and activator (STAT) proteins and thus connects this cytokine to various biological processes. Genetic studies on a mouse model of asthma demonstrated that this cytokine is a determining factor in the pathogenesis of bronchial hyperresponsiveness. IL-9 is a key molecule that affects differentiation of TH17 cells and Treg function. IL-9 predominantly produced by TH17 cells, synergizes with TGF-β1 to differentiate naïve CD4+ T cells into TH17 cells, while IL-9 secretion by TH17 cells is regulated by IL-23. Interestingly, IL-9 enhances the suppressive functions of FoxP3+ CD4+ Treg cells in vitro, and absence of IL-9 signaling weakens the suppressive activity of nTregs in vivo, leading to an increase in effector cells and worsening of experimental autoimmune encephalomyelitis. The mechanism of IL-9 effects on TH17 and Tregs is through activation of STAT3 and STAT5 signaling. Our findings highlight a role of IL-9 as a regulator of pathogenic versus protective mechanisms of immune responses.

  • Elyaman W, et al. (2009) IL-9 induces differentiation of TH17 cells and enhances function of FoxP3+ natural regulatory T cells. Proc Natl Acad Sci U S A. 106(31): 12885-90.
  • Dong Q, et al. (1999) IL-9 induces chemokine expression in lung epithelial cells and baseline airway eosinophilia in transgenic mice. Eur J Immunol. 29(7): 2130-9.
  • Kimura Y, et al. (1995) Sharing of the IL-2 receptor gamma chain with the functional IL-9 receptor complex. Int Immunol. 7(1): 115-20.
  • Size / Price
    Catálogo: RG80459-NY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.