Pedido rápido

Text Size:AAA

Rat Integrin alpha 4/CD49d/ITGA4 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat ITGA4 Información de producto de clon de cDNA
Tamaño de cDNA:3111bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus integrin, alpha 4 with C terminal His tag.
Sinónimo de gen:Itga4
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rat Integrin alpha 4/CD49d/ITGA4 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Rat Integrin alpha 4/CD49d/ITGA4 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80291-ACG$325
Rat Integrin alpha 4/CD49d/ITGA4 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80291-ACR$325
Rat Integrin alpha 4/CD49d/ITGA4 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80291-CF$295
Rat Integrin alpha 4/CD49d/ITGA4 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80291-CH$295
Rat Integrin alpha 4/CD49d/ITGA4 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80291-CM$295
Rat Integrin alpha 4/CD49d/ITGA4 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80291-CY$295
Rat Integrin alpha 4/CD49d/ITGA4 clonación del ADN o clonación génica(Vector de expresión)RG80291-G$75
Rat Integrin alpha 4/CD49d/ITGA4 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80291-NF$295
Rat Integrin alpha 4/CD49d/ITGA4 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80291-NH$295
Rat Integrin alpha 4/CD49d/ITGA4 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80291-NM$295
Rat Integrin alpha 4/CD49d/ITGA4 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80291-NY$295
Rat Integrin alpha 4/CD49d/ITGA4 clonación del ADN o clonación génica(vector de clonación)RG80291-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: RG80291-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.