Pedido rápido

Rat Integrin alpha V/CD51/ITGAV clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Rata ITGAV Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_001106549.1
    Tamaño de cDNA:1506bp
    Descripción de cDNA:Full length Clone DNA of Rattus norvegicus integrin, alpha V with N terminal His tag.
    Sinónimo de gen:Cd51, Itgav
    Especie:Rat
    Vector:pCMV3-SP-N-His
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ITGAV qPCR primers for gene expression analysis, RP300392 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"