After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rat ITGB1 / Integrin beta-1 / CD29 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat ITGB1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_017022.2
Tamaño de cDNA:2397bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus integrin, beta 1 with C terminal His tag.
Sinónimo de gen:Itgb1
Especie:Rat
Vector:pCMV3-C-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rat ITGB1 / Integrin beta-1 / CD29 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Rat ITGB1 / Integrin beta-1 / CD29 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80290-ACG$245
Rat ITGB1 / Integrin beta-1 / CD29 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80290-ACR$245
Rat ITGB1 / Integrin beta-1 / CD29 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80290-CF$215
Rat ITGB1 / Integrin beta-1 / CD29 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80290-CH$215
Rat ITGB1 / Integrin beta-1 / CD29 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80290-CM$215
Rat ITGB1 / Integrin beta-1 / CD29 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80290-CY$215
Rat ITGB1 / Integrin beta-1 / CD29 clonación del ADN o clonación génica(Vector de expresión)RG80290-G$75
Rat ITGB1 / Integrin beta-1 / CD29 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80290-NF$215
Rat ITGB1 / Integrin beta-1 / CD29 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80290-NH$215
Rat ITGB1 / Integrin beta-1 / CD29 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80290-NM$215
Rat ITGB1 / Integrin beta-1 / CD29 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80290-NY$215
Rat ITGB1 / Integrin beta-1 / CD29 clonación del ADN o clonación génica(vector de clonación)RG80290-UT$215
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: RG80290-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"