Pedido rápido

Rat CD61/Integrin beta 3/ITGB3 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

  • Rat CD61/Integrin beta 3/ITGB3 Gene Plasmid Map 17379
Hoja de datosReseñasProductos relacionadosProtocolos
Rata ITGB3 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_153720.1
Tamaño de cDNA:2409 bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus integrin, beta 3 with C terminal His tag.
Sinónimo de gen:Itgb3
Especie:Rat
Vector:pCMV3-C-His
Plasmid:pCMV3-ratITGB3-His
Sitio de restricción:KpnI(two restriction sites) + XbaI(6kb+1.94kb+0.48)
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ITGB3 qPCR primers for gene expression analysis, RP300285 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rat CD61/Integrin beta 3/ITGB3 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Product nameProduct name
Size / Price
Catálogo: RG80312-CH
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
DisponibilidadIn Stock
Añadir a carroBulk Discount Requiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"