Integrin beta 3 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80312-CY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Integrin beta 3 Reagents

CRO Services

Product recommended


All Integrin beta 3 Reagents

Integrin beta 3 cDNA ORF Clone, Rat, C-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2364 bp
Description
Full length Clone DNA of Rat integrin, beta 3 with C terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Integrin beta 3 Background Information

Integrins containing the beta(3) subunit are key players in tumor growth and metastasis.ITGB3 plays an important role in ROS-induced migration and invasion in Colorectal cancer (CRC).ITGB3 is translationally activated in hypoxia and regulates malignant features, including epithelial-mesenchymal transition and cell migration, through the TGF-beta pathway, revealing a novel angle for the treatment of therapy-resistant hypoxic tumours.Bioinformatic algorithms and luciferase reporter assays revealed that integrin beta3 (ITGB3) is a direct target of miR-3a-5p.
Full Name
integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)

Integrin beta 3 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Integrin beta 3 cDNA ORF Clone in Cloning Vector, Rhesus CG90309-G
Integrin beta 3 cDNA ORF Clone, Rhesus, untagged CG90309-UT
Integrin beta 3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90309-ACG
Integrin beta 3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90309-ACGLN
Integrin beta 3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90309-ACR
Integrin beta 3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90309-CF
Integrin beta 3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90309-NF
Integrin beta 3 cDNA ORF Clone, Rhesus, C-His tag CG90309-CH
Integrin beta 3 cDNA ORF Clone, Rhesus, N-His tag CG90309-NH
Integrin beta 3 cDNA ORF Clone, Rhesus, C-HA tag CG90309-CY
Integrin beta 3 cDNA ORF Clone, Rhesus, N-HA tag CG90309-NY
Integrin beta 3 cDNA ORF Clone, Rhesus, C-Myc tag CG90309-CM
Integrin beta 3 cDNA ORF Clone, Rhesus, N-Myc tag CG90309-NM

Integrin beta 3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Integrin beta 3 cDNA ORF Clone in Cloning Vector, Rat RG80312-G
Integrin beta 3 cDNA ORF Clone, Rat, untagged RG80312-UT
Integrin beta 3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80312-ACG
Integrin beta 3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80312-ACGLN
Integrin beta 3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80312-ACR
Integrin beta 3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80312-CF
Integrin beta 3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80312-NF
Integrin beta 3 cDNA ORF Clone, Rat, C-His tag RG80312-CH
Integrin beta 3 cDNA ORF Clone, Rat, N-His tag RG80312-NH
Integrin beta 3 cDNA ORF Clone, Rat, N-HA tag RG80312-NY
Integrin beta 3 cDNA ORF Clone, Rat, C-Myc tag RG80312-CM
Integrin beta 3 cDNA ORF Clone, Rat, N-Myc tag RG80312-NM
Integrin beta 3 qPCR Primer Pairs, Rat RP300285

Integrin beta 3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Integrin beta 3 cDNA ORF Clone in Cloning Vector, Mouse MG50080-M
Integrin beta 3 cDNA ORF Clone, Mouse, untagged MG50080-UT
Integrin beta 3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50080-ACGLN
Integrin beta 3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50080-ACG
Integrin beta 3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50080-ACR
Integrin beta 3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50080-CF
Integrin beta 3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50080-NF
Integrin beta 3 cDNA ORF Clone, Mouse, C-His tag MG50080-CH
Integrin beta 3 cDNA ORF Clone, Mouse, N-His tag MG50080-NH
Integrin beta 3 cDNA ORF Clone, Mouse, C-HA tag MG50080-CY
Integrin beta 3 cDNA ORF Clone, Mouse, N-HA tag MG50080-NY
Integrin beta 3 cDNA ORF Clone, Mouse, C-Myc tag MG50080-CM
Integrin beta 3 cDNA ORF Clone, Mouse, N-Myc tag MG50080-NM
Integrin beta 3 qPCR Primer Pairs, Mouse MP200111

Integrin beta 3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Integrin beta 3 cDNA ORF Clone in Cloning Vector, Human HG10787-M
Integrin beta 3 cDNA ORF Clone, Human, untagged HG10787-UT
Integrin beta 3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10787-ACGLN
Integrin beta 3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10787-ACG
Integrin beta 3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10787-ACR
Integrin beta 3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10787-CF
Integrin beta 3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10787-NF
Integrin beta 3 cDNA ORF Clone, Human, C-His tag HG10787-CH
Integrin beta 3 cDNA ORF Clone, Human, N-His tag HG10787-NH
Integrin beta 3 cDNA ORF Clone, Human, C-HA tag HG10787-CY
Integrin beta 3 cDNA ORF Clone, Human, N-HA tag HG10787-NY
Integrin beta 3 cDNA ORF Clone, Human, C-Myc tag HG10787-CM
Integrin beta 3 cDNA ORF Clone, Human, N-Myc tag HG10787-NM
Integrin beta 3 qPCR Primer Pairs, Human HP100908
info info
添加购物车成功! 添加购物车失败!