Jagged 1 cDNA ORF Clone, Rat, N-Myc tag

Price:
Size:
Number:

Jagged 1 cDNA ORF Clone, Rat, N-Myc tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3660 bp
Description
Full length Clone DNA of Rat jagged 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Jagged 1 Background Information

Protein Jagged 1, also known as JAG1, JAGL1 and CD339, is a single-pass type I membrane protein which contains 1DSL domain and 15EGF-like domains. JAG1/Jagged 1 is widely expressed in adult and fetal tissues. The expression of JAG1/Jagged 1 is up-regulated in cervical squamous cell carcinoma. JAG1/Jagged 1 is also expressed in bone marrow cell line HS-27a which supports the long-term maintenance of immature progenitor cells. JAG1/Jagged 1 is a ligand for multiple Notch receptors. It is involved in the mediation of Notch signaling. JAG1/Jagged 1 may be involved in cell-fate decisions during hematopoiesis. JAG1/Jagged 1 seems to be involved in early and late stages of mammalian cardiovascular development. It inhibits myoblast differentiation and enhances fibroblast growth factor-induced angiogenesis. Defects in JAG1/Jagged 1 are the cause of Alagille syndrome type 1 (ALGS1). Alagille syndrome is an autosomal dominant multisystem disorder defined clinically by hepatic bile duct paucity and cholestasis in association with cardiac, skeletal, and ophthalmologic manifestations. Defects in JAG1/Jagged 1 are also a cause of tetralogy of Fallot (TOF). TOF is a congenital heart anomaly which consists of pulmonary stenosis, ventricular septal defect, dextroposition of the aorta (aorta is on the right side instead of the left) and hypertrophy of the right ventricle. This condition results in a blue baby at birth due to inadequate oxygenation.
Full Name
jagged 1
References
  • Oda T.et al., 1997, Nat. Genet. 16:235-242.
  • Krantz I.D. et al., 1998, Am. J. Hum. Genet. 62:1361-1369.
  • Li L. et al., 1998, Immunity. 8:43-55.
  • Jones E.A. et al., 2000, J. Med. Genet. 37: 658-662.
  • Roepke A.et al., 2003, Hum. Mutat. 21:100-100.
  • Jurkiewicz D.et al., 2005, Hum. Mutat. 25:321-321.
  • Warthen D.M.et al., 2006, Hum. Mutat. 27:436-443.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait