Pedido rápido

Rat KIT / c-KIT / CD117 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Rata KIT Información de producto de clon de cDNA
    Tamaño de cDNA:2937bp
    Descripción de cDNA:Full length Clone DNA of Rattus norvegicus v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog with C terminal HA tag.
    Sinónimo de gen:Kit
    Sitio de restricción:
    Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descripción de la secuencia:
    ( We provide with KIT qPCR primers for gene expression analysis, RP300292 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Rat KIT / c-KIT / CD117 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
    Product nameProduct name

    C-Kit is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). c-Kit contains 5 Ig-like C2-type (immunoglobulin-like) domains.and 1 protein kinase domain. It belongs to the protein kinase superfamily, tyr protein kinase family and CSF-1/PDGF receptor subfamily. C-Kit contains 5 Ig-like C2-type (immunoglobulin-like) domains and 1 protein kinase domain. C-Kit has a tyrosine-protein kinase activity. Binding of the ligands leads to the autophosphorylation of KIT and its association with substrates such as phosphatidylinositol 3-kinase. Antibodies to c-Kit are widely used in immunohistochemistry to help distinguish particular types of tumour in histological tissue sections. It is used primarily in the diagnosis of GISTs. In GISTs, c-Kit staining is typically cytoplasmic, with stronger accentuation along the cell membranes. C-Kit antibodies can also be used in the diagnosis of mast cell tumours and in distinguishing seminomas from embryonal carcinomas. Mutations in c-Kit gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Defects in KIT are a cause of acute myelogenous leukemia (AML). AML is a malignant disease in which hematopoietic precursors are arrested in an early stage of development. Note=Somatic mutations that lead to constitutive activation of KIT are detected in AML patients.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Andre C, et al. (1997) Sequence analysis of two genomic regions containing the KIT and the FMS receptor tyrosine kinase genes. Genomics. 39(2):216-26.
  • Yarden Y, et al. (1987) Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand. EMBO J. 6(11):3341-51.
  • Leong KG, et al. (2008) Generation of a prostate from a single adult stem cell. Nature. 456(7223): 804-8.
  • Edling CE, et al. (2007) c-Kit--a hematopoietic cell essential receptor tyrosine kinase. Int J Biochem Cell Biol. 39(11):1995-8.
  • McIntyre A, et al. (2005) Amplification and overexpression of the KIT gene is associated with progression in the seminoma subtype of testicular germ cell tumors of adolescents and adults. Cancer Res. 65(18):8085-9.
  • Size / Price
    Catálogo: RG80321-CY
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.