Pedido rápido

Rat NKG2A / NKG2 / CD159A / KLRC1 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rata KLRC1 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001037441.1
Tamaño de cDNA:711bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus killer cell lectin-like receptor subfamily C, member 1 with C terminal HA tag.
Sinónimo de gen:rNKG2A, Klrc1
Especie:Rat
Vector:pCMV3-C-HA
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with KLRC1 qPCR primers for gene expression analysis, RP300246 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Rat NKG2A / NKG2 / CD159A / KLRC1 clonación del ADN o clonación génica(vector de clonación), C-HA Etiqueta on other vectors
Rat NKG2A / NKG2 / CD159A / KLRC1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80370-ACG$225
Rat NKG2A / NKG2 / CD159A / KLRC1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80370-ACR$225
Rat NKG2A / NKG2 / CD159A / KLRC1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80370-CF$195
Rat NKG2A / NKG2 / CD159A / KLRC1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80370-CH$195
Rat NKG2A / NKG2 / CD159A / KLRC1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80370-CM$195
Rat NKG2A / NKG2 / CD159A / KLRC1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80370-CY$195
Rat NKG2A / NKG2 / CD159A / KLRC1 clonación del ADN o clonación génica(Vector de expresión)RG80370-G$75
Rat NKG2A / NKG2 / CD159A / KLRC1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80370-NF$195
Rat NKG2A / NKG2 / CD159A / KLRC1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80370-NH$195
Rat NKG2A / NKG2 / CD159A / KLRC1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80370-NM$195
Rat NKG2A / NKG2 / CD159A / KLRC1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80370-NY$195
Rat NKG2A / NKG2 / CD159A / KLRC1 clonación del ADN o clonación génica(vector de clonación)RG80370-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

NKG2, also known as NKG2A(CD159A), is a member of the killer cell lectin-like receptor family. This family is a group of transmembrane proteins preferentially expressed in NK cells. Members of this fmaily are characterized by the type II membrane orientation and the presence of a C-type lectin domain. NKG2 contains 1 C-type lectin domain and forms a complex with another family member, KLRD1/CD94. It is expressed only in NK-cells, but not in T-cells or B-cells. It has been shown that NKG2 represents a family of related cDNA clones, designated NKG2A, NKG2B, NKG2C, and NKG2D, which encode type 2 integral membrane proteins (extracellular C-terminus) containing a C-type lectin domain. Natural killer (NK) cells are lymphocytes that can mediate lysis of certain tumor cells and virus-infected cells without previous activation. They can also regulate specific humoral and cell-mediated immunity. NKG2 functions as a receptor for the recognition of MHC class I HLA-E molecules by NK cells and some cytotoxic T-cells.

Referencias
  • Angelini DF, et al. (2011) NKG2A inhibits NKG2C effector functions of gamma delta T cells: implications in health and disease. J Leukoc Biol. 89(1):75-84.
  • Ge SJ, et al. (2011) Expression of NKG2D and NKG2A with their ligands MHC-I A/B and HLA-E in acute leukemia patients and its significance. Zhongguo Shi Yan Xue Ye Xue Za Zhi. 19(2):312-6.
  • Ablamunits V, et al. (2011) NKG2A is a marker for acquisition of regulatory function by human CD8+ T cells activated with anti-CD3 antibody. Eur J Immunol. 41(7):1832-42.
  • Size / Price
    Catálogo: RG80370-CY
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"