After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Rat LGALS4 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_012975.1
Tamaño de cDNA:975bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus lectin, galactoside-binding, soluble, 4.
Sinónimo de gen:L-36, L36LBI, Lgals4
Especie:Rat
Vector:pCMV3-untagged
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación) on other vectors
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80253-ACG$225
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80253-ACR$225
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG80253-ANG$225
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG80253-ANR$225
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80253-CF$195
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80253-CH$195
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80253-CM$195
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80253-CY$195
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(Vector de expresión)RG80253-G$75
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80253-NF$195
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80253-NH$195
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80253-NM$195
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80253-NY$195
Rat Galectin-4/LGALS4 clonación del ADN o clonación génica(vector de clonación)RG80253-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: RG80253-UT
Precio de lista: 
Precio:      (You Save: )
Tamaño:
Cantidad:+-
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"