After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rat LILRA5 clonación del ADN o clonación génica(vector de clonación), N-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat LILRA5 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001076793.1
Tamaño de cDNA:888bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 with N terminal His tag.
Sinónimo de gen:Lilrc1, Lilra5
Especie:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fondo

LILRA5 is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LILR are a family of receptors possessing extracellular immunoglobulin domains. They are also known as CD85, ILTs and LIR, and can exert immunomodulatory effects on a wide range of immune cells. ILT-11 contains 2 Ig-like C2-type (immunoglobulin-like) domains. It can be detected n tissues of the hematopoietic system, including bone marrow, spleen, lymph node and peripheral leukocytes. Crosslink of ILT-11 on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses.

Referencias
  • Wende H, et al. (2000) Extensive gene duplications and a large inversion characterize the human leukocyte receptor cluster. Immunogenetics. 51(8-9):703-13.
  • Jones DC, et al. (2009) Alternative mRNA splicing creates transcripts encoding soluble proteins from most LILR genes. Eur J Immunol. 39(11):3195-206.
  • Mosbruger TL, et al. (2010) Large-scale candidate gene analysis of spontaneous clearance of hepatitis C virus. J Infect Dis. 201(9):1371-80.
  • Size / Price
    Catálogo: RG80334-NH
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"