C10orf10 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80798-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All C10orf10 Reagents

CRO Services

Product recommended


All C10orf10 Reagents

C10orf10 cDNA ORF Clone, Rat, N-HA tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
618 bp
Description
Full length Clone DNA of Rat similar to hypothetical protein MGC6835 with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

C10orf10 Background Information

Full Name
chromosome 10 open reading frame 10

C10orf10 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
C10orf10 cDNA ORF Clone in Cloning Vector, Rat RG80798-U
C10orf10 cDNA ORF Clone, Rat, untagged RG80798-UT
C10orf10 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80798-ACG
C10orf10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80798-ACGLN
C10orf10 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80798-ANG
C10orf10 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80798-ACR
C10orf10 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80798-ANR
C10orf10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80798-CF
C10orf10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80798-NF
C10orf10 cDNA ORF Clone, Rat, C-His tag RG80798-CH
C10orf10 cDNA ORF Clone, Rat, N-His tag RG80798-NH
C10orf10 cDNA ORF Clone, Rat, C-HA tag RG80798-CY
C10orf10 cDNA ORF Clone, Rat, C-Myc tag RG80798-CM
C10orf10 cDNA ORF Clone, Rat, N-Myc tag RG80798-NM
C10orf10 qPCR Primer Pairs, Rat RP300762

C10orf10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
C10orf10 cDNA ORF Clone in Cloning Vector, Human HG17068-U
C10orf10 cDNA ORF Clone, Human, untagged HG17068-UT
C10orf10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17068-ACGLN
C10orf10 cDNA ORF Clone, Human, C-GFPSpark® tag HG17068-ACG
C10orf10 cDNA ORF Clone, Human, N-GFPSpark® tag HG17068-ANG
C10orf10 cDNA ORF Clone, Human, C-OFPSpark® tag HG17068-ACR
C10orf10 cDNA ORF Clone, Human, N-OFPSpark® tag HG17068-ANR
C10orf10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17068-CF
C10orf10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17068-NF
C10orf10 cDNA ORF Clone, Human, C-His tag HG17068-CH
C10orf10 cDNA ORF Clone, Human, N-His tag HG17068-NH
C10orf10 cDNA ORF Clone, Human, C-HA tag HG17068-CY
C10orf10 cDNA ORF Clone, Human, N-HA tag HG17068-NY
C10orf10 cDNA ORF Clone, Human, C-Myc tag HG17068-CM
C10orf10 cDNA ORF Clone, Human, N-Myc tag HG17068-NM
info info
添加购物车成功! 添加购物车失败!