After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Rat TNF-beta/TNFSF1/Lymphotoxin alpha clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat LTA Información de producto de clon de cDNA
Gene_bank_ref_id:NM_080769.2
Tamaño de cDNA:609bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus lymphotoxin alpha (TNF superfamily, member 1) with N terminal Flag tag.
Sinónimo de gen:Tnfb, Tnfsf1, Lta
Especie:Rat
Vector:pCMV3-SP-N-FLAG
Plasmid:
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rat TNF-beta/TNFSF1/Lymphotoxin alpha clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Rat TNF-beta/TNFSF1/Lymphotoxin alpha clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80147-ACG$225
Rat TNF-beta/TNFSF1/Lymphotoxin alpha clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80147-ACR$225
Rat TNF-beta/TNFSF1/Lymphotoxin alpha clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80147-CF$195
Rat TNF-beta/TNFSF1/Lymphotoxin alpha clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80147-CH$195
Rat TNF-beta/TNFSF1/Lymphotoxin alpha clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80147-CM$195
Rat TNF-beta/TNFSF1/Lymphotoxin alpha clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80147-CY$195
Rat TNF-beta/TNFSF1/Lymphotoxin alpha clonación del ADN o clonación génica(Vector de expresión)RG80147-G$75
Rat TNF-beta/TNFSF1/Lymphotoxin alpha clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80147-NF$195
Rat TNF-beta/TNFSF1/Lymphotoxin alpha clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80147-NH$195
Rat TNF-beta/TNFSF1/Lymphotoxin alpha clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80147-NM$195
Rat TNF-beta/TNFSF1/Lymphotoxin alpha clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80147-NY$195
Rat TNF-beta/TNFSF1/Lymphotoxin alpha clonación del ADN o clonación génica(vector de clonación)RG80147-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Lymphotoxin-alpha, also known as LT-alpha, TNF-beta, Tumor necrosis factor ligand superfamily member 1, LTA TNFSF1 and TNFB, is a secreted protein which belongs to the tumor necrosis factor family. TNF-beta/TNFSF1/Lymphotoxin alpha is a highly inducible, secreted, and exists as homotrimeric molecule. It is a cytokine that in its homotrimeric form binds to TNFRSF1A / TNFR1, TNFRSF1B / TNFBR and TNFRSF14 / HVEM. In its heterotrimeric form with LTB, TNF-beta/TNFSF1/Lymphotoxin alpha binds to TNFRSF3 / LTBR. Lymphotoxin is produced by lymphocytes and cytotoxic for a wide range of tumor cells. TNF-beta/TNFSF1/Lymphotoxin alpha forms heterotrimers with lymphotoxin-beta which anchors lymphotoxin-alpha to the cell surface. It mediates a large variety of inflammatory, immunostimulatory, and antiviral responses. TNF-beta/TNFSF1/Lymphotoxin alpha is also involved in the formation of secondary lymphoid organs during development and plays a role in apoptosis. Genetic variations in TNF-beta/TNFSF1/Lymphotoxin alpha are a cause of susceptibility psoriatic arthritis which is an inflammatory, seronegative arthritis associated with psoriasis. It is a heterogeneous disorder ranging from a mild, non-destructive disease to a severe, progressive, erosive arthropathy.

Referencias
  • Messer G, et al. (1991) Polymorphic structure of the tumor necrosis factor (TNF) locus: an NcoI polymorphism in the first intron of the human TNF-beta gene correlates with a variant amino acid in position 26 and a reduced level of TNF-beta production. J Exp Med. 173(1): 209-19.
  • Banner DW, et al. (1993) Crystal structure of the soluble human 55 kd TNF receptor-human TNF beta complex: implications for TNF receptor activation. Cell. 73(3): 431-45.
  • Picarella DE, et al. (1993) Transgenic tumor necrosis factor (TNF)-alpha production in pancreatic islets leads to insulitis, not diabetes. Distinct patterns of inflammation in TNF-alpha and TNF-beta transgenic mice. J Immunol. 150(9): 4136-50.
  • Size / Price
    Catálogo: RG80147-NF
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"