Pedido rápido

Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación)

    Hoja de datosReseñasProductos relacionadosProtocolos
    Rata MDH1 Información de producto de clon de cDNA
    Gene_bank_ref_id:NM_033235.1
    Tamaño de cDNA:1005bp
    Descripción de cDNA:Full length Clone DNA of Rattus norvegicus malate dehydrogenase 1, NAD (soluble).
    Sinónimo de gen:MDL1, Mdhl, Mor2, Mdh1
    Especie:Rat
    Vector:pCMV3-untagged
    Plasmid:
    Sitio de restricción:
    Secuencia de etiquetas:
    Descripción de la secuencia:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MDH1 qPCR primers for gene expression analysis, RP300219 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación) on other vectors
    Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80232-ACG$225
    Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80232-ACR$225
    Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG80232-ANG$225
    Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG80232-ANR$225
    Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80232-CF$195
    Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80232-CH$195
    Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80232-CM$195
    Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80232-CY$195
    Rat MDHA / MDH1 clonación del ADN o clonación génica(Vector de expresión)RG80232-G$75
    Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80232-NF$195
    Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80232-NH$195
    Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80232-NM$195
    Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80232-NY$195
    Rat MDHA / MDH1 clonación del ADN o clonación génica(vector de clonación)RG80232-UT$195
     Más información sobre los vectores de expresión
    Product nameProduct name
    Fondo

    Malate dehydrogenases 1(MDH1 / MDHA) is soluable form of malate dehydrogenases. Malate dehydrogenases (MDH) is a group of multimeric enzymes consisting of identical subunits usually organized as either dimer or tetramers with subunit molecular weights of 30-35 kDa. MDH has been isolated from different sources including archaea, eubacteria, fungi, plant and mammals. MDH catalyzes the NAD/NADH-dependent interconversion of the substrates malate and oxaloacetate. This reaction plays a key part in the malate / aspartate shuttle across the mitochondrial membrane, and in the tricarboxylic acid cycle within the mitochondrial matrix. The enzymes share a common catalytic mechanism and their kinetic properties are similar, which demonstrates a high degree of structural similarity. The three-dimensional structures and elements essential for catalysis are conserved between mitochondrial and cytoplasmic forms of MDH in eukaryotic cells even though these isoenzymes are only marginally related at the level of primary structure. 

    Referencias
  • Minarik P, et al. (2002) Malate dehydrogenases--structure and function. Gen Physiol Biophys. 21 (3): 257-65.
  • Musrati RA, et al. (1998) Malate dehydrogenase: distribution, function and properties. Gen Physiol Biophys. 17 (3): 193-210.
  • Hall MD, et al. (1992) Crystal structure of Escherichia coli malate dehydrogenase. A complex of the apoenzyme and citrate at 1.87 A resolution. J Mol Biol. 226 (3): 867-82.
  • Size / Price
    Catálogo: RG80232-UT
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    Disponibilidad
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"