Pedido rápido

Text Size:AAA

Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat MYOT Información de producto de clon de cDNA
Tamaño de cDNA:1491bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus myotilin with C terminal His tag.
Sinónimo de gen:Ttid
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG81047-ACG$225
Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG81047-ACR$225
Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG81047-ANG$225
Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG81047-ANR$225
Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG81047-CF$195
Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG81047-CH$195
Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG81047-CM$195
Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG81047-CY$195
Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG81047-NF$195
Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG81047-NH$195
Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG81047-NM$195
Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG81047-NY$195
Rat MYOT/Myotilin clonación del ADN o clonación génica(Vector de expresión)RG81047-U$75
Rat MYOT/Myotilin clonación del ADN o clonación génica(vector de clonación)RG81047-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.