Pedido rápido

Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat NONO Información de producto de clon de cDNA
Tamaño de cDNA:1431bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus non-POU domain containing, octamer-binding with C terminal His tag.
Sinónimo de gen:Nono
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG81632-ACG$225
Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG81632-ACR$225
Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG81632-ANG$225
Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG81632-ANR$225
Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG81632-CF$195
Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG81632-CH$195
Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG81632-CM$195
Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG81632-CY$195
Rat NONO/p54nrb clonación del ADN o clonación génica(Vector de expresión)RG81632-G$75
Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG81632-NF$195
Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG81632-NH$195
Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG81632-NM$195
Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG81632-NY$195
Rat NONO/p54nrb clonación del ADN o clonación génica(vector de clonación)RG81632-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Size / Price
Catálogo: RG81632-CH
Precio de lista: 
Precio:      (You Save: )
Disponibilidad2-3 weeks
Bulk Discount RequiryAñadir a carro
Contact Us
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.