Pedido rápido

Text Size:AAA

Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat NUDT5 Información de producto de clon de cDNA
Tamaño de cDNA:660bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus nudix (nucleoside diphosphate linked moiety X)-type motif 5 with C terminal Flag tag.
Sinónimo de gen:Nudt5
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación), C-Flag Etiqueta on other vectors
Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG81109-ACG$225
Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG81109-ACR$225
Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG81109-ANG$225
Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG81109-ANR$225
Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG81109-CF$195
Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG81109-CH$195
Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG81109-CM$195
Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG81109-CY$195
Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG81109-NF$195
Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG81109-NH$195
Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG81109-NM$195
Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG81109-NY$195
Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(Vector de expresión)RG81109-U$75
Rat ADP-sugar Pyrophosphatase/NUDT5 clonación del ADN o clonación génica(vector de clonación)RG81109-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

ADP-sugar Pyrophosphatase, also known as NUDT5, eliminates toxic nucleotide derivatives from the cell and regulate the levels of important signaling nucleotides and their metabolites. NUDT5 functions as a MutT-related protein and catalyzes the hydrolysis of 8-oxoGDP to 8-oxoGMP, thereby preventing misincorporation of 8-oxoGua into RNA. NUDT5 may play significant roles in regulating the G1-S transition in mammalian cells. It can also hydrolyze other nucleotide sugars with low activity.

  • Ishibashi T. et al., 2004, EMBO Rep. 4 (5): 479-8.
  • Gerhard DS. et al., 2004, Genome Res. 14 (10B): 2121-7.
  • Rush J. et al., 2005, Nat Biotechnol. 23 (1): 94-101.
  • Kamiya H. et al., 2009, DNA Repair. 8 (10): 1250-4.
  • Size / Price
    Catálogo: RG81109-CF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.