After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rat PD1/PDCD1/CD279 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat PDCD1 Información de producto de clon de cDNA
Tamaño de cDNA:854bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus programmedcelldeath1 with N terminal HA tag.
Sinónimo de gen:Pdcd1
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Programmed cell death 1, also known as PDCD1, is a type I transmembrane glycoprotein, and is an immunoreceptor belonging to the CD28/CTLA-4 family negatively regulates antigen receptor signaling by recruiting protein tyrosine phosphatase, SHP-2 upon interacting with either of two ligands, PD-L1 or PD-L2. PD1 inhibits the T-cell proliferation and production of related cytokines including IL-1, IL-4, IL-10 and IFN-γ by suppressing the activation and transduction of PI3K/AKT pathway. In addition, coligation of PD1 inhibits BCR-mediating signal by dephosphorylating key signal transducer. PD1 has been suggested to be involved in lymphocyte clonal selection and peripheral tolerance, and thus contributes to the prevention of autoimmune diseases. Furthermore, PD1 is shown to be a regulator of virus-specific CD8+ T cell survival in HIV infection. As a cell surface molecule, PDCD1 regulates the adaptive immune response. Engagement of PD-1 by its ligands PD-L1 or PD-L2 transduces a signal that inhibits T-cell proliferation, cytokine production, and cytolytic function.

  • James ES, et al. (2005) PDCD1: a tissue-specific susceptibility locus for inherited inflammatory disorders. Genes Immun. 6(5): 430-7.
  • Okazaki T, et al. (2007) PD-1 and PD-1 ligands: from discovery to clinical application. Int Immunol. 19(7): 813-24.
  • del Rio ML, et al. (2008) PD-1/PD-L1, PD-1/PD-L2, and other co-inhibitory signaling pathways in transplantation. Transpl Int. 21(11): 1015-28.
  • Riley JL.(2009) PD-1 signaling in primary T cells. Immunol Rev. 229(1): 114-25.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.