Pedido rápido

Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat PTPRC Información de producto de clon de cDNA
Tamaño de cDNA:3426bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus protein tyrosine phosphatase, receptor type, C, transcript variant 1 with C terminal His tag.
Sinónimo de gen:Lca, RT7, CD45, L-CA, T200, Ptprc
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His Etiqueta on other vectors
Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaRG80296-ACG$325
Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaRG80296-ACR$325
Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaRG80296-ANG$325
Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaRG80296-ANR$325
Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaRG80296-CF$295
Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaRG80296-CH$295
Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaRG80296-CM$295
Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaRG80296-CY$295
Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(Vector de expresión)RG80296-G$75
Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaRG80296-NF$295
Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaRG80296-NH$295
Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaRG80296-NM$295
Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaRG80296-NY$295
Rat CD45/PTPRC transcript variant 1 clonación del ADN o clonación génica(vector de clonación)RG80296-UT$295
 Más información sobre los vectores de expresión
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Protein tyrosine phosphatase, receptor type C (CD45), also known as PTPRC is a member of the protein tyrosine phosphatase (PTP) family which is known for its function to serve as signaling molecules and to regulate a variety of cellular processes such as cell proliferation, differentiation, mitotic cycle and oncogenic transformation. CD45 is found expression specifically in hemotopietic cells. CD45 consists of an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains. It serves as an essential regulator of T-cell and B-cell antigen receptor signaling through either direct interaction with components of the antigen receptor complexs or by activating various Src family kinases required for the antigen receptor signaling and it also can suppress JAK kinases.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Irie-Sasaki J, et al. (2001) CD45 is a JAK phosphatase and negatively regulates cytokine receptor signaling. Nature. 409: 349-54.
  • Size / Price
    Catálogo: RG80296-CH
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.