S100A6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Price:
Size:
Number:

S100A6 cDNA ORF Clone, Rat, C-DDK (Flag®) tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
270 bp
Description
Full length Clone DNA of Rat S100 calcium binding protein A6 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

S100A6 Background Information

S1 proteinis a family of low molecular weight protein found in vertebrates characterized by twoEF-hand calcium-binding motifs. There are at least 21 different S1 proteins, and the name is derived from the fact that the protein is1%soluble in ammonium sulfateat neutralpH. Most S1 proteins are disulfide-linked homodimer, and is normally present in cells derived from theneural crest, chondrocytes, macrophages, dendritic cells, etc. S1 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response. S1A6 (S1 calcium binding protein A6) is a member of the S1 family of proteins, and functions in prolactin secretion, and exocytosis. Chromosomal rearrangements and altered expression of S1A6 have been implicated in melanoma.
Full Name
S100 calcium binding protein A6
References
  • Schäfer, B.W. et al., 1996, Trends Biochem. Sci. 21 (4): 134-140.
  • Donato,R. et al., 2003, Microsc. Res. Tech. 60 (6): 540-551.
  • Nowotny, M. et al., 2003, J. Biol. Chem. 278 (29): 26923-26928.
  • Nonaka D, et al., 2008, J. Cutan. Pathol. 35 (11): 1014-1019.
  • Marenholz, I. et al., 2004, Biochem. Biophys. Res. Commun. 322 (4): 1111-22. 
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait