Pedido rápido

Text Size:AAA

Rat PAI-1 / SerpinE1 clonación del ADN o clonación génica(vector de clonación), N-HA Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat SERPINE1 Información de producto de clon de cDNA
Tamaño de cDNA:1209bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1 with N terminal HA tag.
Sinónimo de gen:Pai1, PAI1A, Planh, Pai1aa, RATPAI1A
Sitio de restricción:
Secuencia de etiquetas:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Plasminogen activator inhibitor 1, also known as PAI-1, Endothelial plasminogen activator inhibitor, SerpinE1 and PLANH1, is a secreted glycoprotein which belongs to the serpin family. SerpinE1 is the primary physiological inhibitor of the two plasminogen activators urokinase (uPA) and tissue plasminogen activator (tPA). Its rapid interaction with TPA may function as a major control point in the regulation of fibrinolysis. Defects in SerpinE1 are the cause of plasminogen activator inhibitor-1 deficiency (PAI-1 deficiency) which is characterized by abnormal bleeding due to SerpinE1 defect in the plasma. High concentrations of SerpinE1 have been associated with thrombophilia which is an autosomal dominant disorder in which affected individuals are prone to develop serious spontaneous thrombosis. Studies of PAI-1 have contributed significantly to the elucidation of the protease inhibitory mechanism of serpins, which is based on a metastable native state becoming stabilised by insertion of the RCL into the central beta-sheet A and formation of covalent complexes with target proteases. Greater expression of PAI-1 has been associated with increased survival of cells and resistance to apoptosis. PAI-1 appears to influence apoptosis by decreasing cell adhesion (anoikis) as well as its effect on intracellular signaling. PAI-1, in its active state, also binds to the extracellular protein vitronectin. When in complex with its target proteases, it binds with high affinity to endocytosis receptors of the low density receptor family. The mechanisms of PAI-1 overexpression during obesity are complex, and it is conceivable that several inducers are involved at the same time at several sites of synthesis. PAI-1 is also implicated in adipose tissue development. It suggests that PAI-1 inhibitors serve in the control of atherothrombosis.

  • Alessi MC, et al. (2006) PAI-1 and the metabolic syndrome: links, causes, and consequences. Arterioscler Thromb Vasc Biol. 26(10): 2200-7.
  • Schneider DJ, et al. (2008) The effect of plasminogen activator inhibitor type 1 on apoptosis. Thromb Haemost. 100(6): 1037-40.
  • Dupont DM, et al. (2009) Biochemical properties of plasminogen activator inhibitor-1. Front Biosci. 14: 1337-61.
  • Size / Price
    Catálogo: RG80442-NY
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.